Biological Study of protease produced by clinical isolates of Staphylococcus aureus

 

Raghad Abdulatif Abdulrazaq¹, Waqas Saadi Mahmood², Baydaa Alwan³, Tahreer Hadi Saleh⁴

Saba T. Hashim⁵, Bahaa Abdullah Laftaah Al-Rubaii⁴*

^1,3,4,5Department of Biology, College of Science, Mustansiriyah University, Baghdad, Iraq.

²Tikrit University, College of Science, Biology Department.

⁶Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq.

 

ABSTRACT:

The bacterial isolates were obtained from Al-Kindi Hospital were diagnosed by the Vitek-2 system and re confirm by 16srRNA gene as S. aurous, the results were shown 20 isolates (66.7%) out of 30 isolates were positive to protease production. All bacterial isolates (100%) were sensitive to Gentamicin and Levofloxacin. but resistant (100%) to aztreonam. The best temperature for enzyme production from bacteria was 37 °C, and the best pH for enzyme production was 7. Partial purification of the bacterial enzyme (protease) was carried out using short steps included ammonium sulfate 65% saturation, ion exchange using DEAE- cellulose column and then applied on gel filtration chromatography using Sephadex G-200 column. The enzymatic activity was determined for each purification step. The specific fold and yield of the purified enzyme were 5.91 and 38.3 % respectively. The molecular weight of the purified enzyme was 37 kDa , it was determined by SDS-PAGE. After being exposed to high concentrations of the protease enzyme (800-1000 µg/ml), the proliferation of a breast cancer cell line (MCF-7) was seen to be suppressed, however the inhibitory effect gradually diminished as the concentration of the enzyme decreased. 200–400 µg/ml is the recommended concentration.

 

 

INTRODUCTION:

Staphylococcus aureus is characterized by being spherical, gram-positive, belonging to the family of Micrococaceae¹. These bacteria are causing many diseases, including pneumonia, mastitis, meningitis, osteomyelitis, endocarditis, and superficial skin lesions such as furunculosis². due to their secretion of many enzymes, such as Protease, hyaluronidase, leukocidin, Hemolysin, and Leukotoxin³. Protease is found in all living things in the form of large and complex groups of enzymes, and it plays an important role in natural and abnormal physiological conditions⁴, and has a significant role and importance, as it enters many industries (food industries) such as (cheese and meat), as well as detergents and in natural treatments such as treating skin burns.

 

 

It was noted that protease enzymes produced from microorganisms play a large and important role in the resistance of these organisms to abnormal conditions and the diseases they cause⁵.

 

MATERIALS AND METHODS:

Samples collection and diagnosis:

The bacterial isolates were obtained from Al-Kindi Hospital and were diagnosed by the Vitek-2 system and re-confirm by the molecular method. A specific primers forward 5' TCGTTTAACACGTTTAGGTTCA '3 and Revers 5' GAACTGTATCAGTTGGTTTCGCAC '3 were used for amplification 756 bp of 16srRNA gene using PCR technique according to⁶.

 

Antibiotics susceptibility:

Kirby and Bauer disc method was used to perform this test. The antibiotics, included Norfloxacin, Imipenem, Aztreonam, Cefixime, Gentamycin, Levofloxacin, Azithromycin, Ceftriaxone, Cephalothen., Amikacin Ampicillin and Amoxicillin +Clavulanic acid (Augmentin)⁷.

Measuring protease:

The semi-quantitative method was applied to screening ability of hydrolysis of casein protein and clear formation zone around colonies by production medium used for the producing protease which consists of the following substances (g/l) (casein 15, glycerol 10, yeast extract 5, 0.01Mncl2.H2O, 0.2 MgSO₄.7H₂O, 2.4 KHPO₄, 0.4KH₂PO₄,0.74Cacl₂, distilled water 1 liter) ⁸. The enzymatic activity was done by Manachini and his coworker method. It is briefly, Inoculate the production medium with 100μl fresh culture bacterial isolate and incubated with shaker incubator (150rpm) at 37°C for 24 hours, the pellets was removed by centrifugation. The supernatants were evaluated for protease activity. A 1% casein solution (w/v) was tested; 0.8ml casein and 0.2 ml enzyme incubated for 30 minutes at 37°C. The reaction was stopped by added 1ml of TCA reagent, and then the mixture was centrifugation for 20 minute. The bank solution was prepared by added 1ml TCA reagent to the casein solution before mixed with the enzyme solution, and then both tubes ( test and bank) measuring at 280nm. The enzyme activity defined as the amount of enzyme required to induce a 0.01 increase in absorbance at 280nm per minute⁹.

 

The optimum pH, The optimum temperature for enzyme production:

Adjust the acidic function of the culture medium for protease synthesis to find the optimum pH (6-6.5-7-7.5-8-8.5-9). To extract the enzyme, S. aureus germs were added to the culture medium and cultured at 37°C for 24 hours. The optimum temperature for production was done by incubating bacterial culture media at various temperatures (27-37-47-57)°C for 24 hours and then measuring the activity of the enzyme generated by the bacteria after extraction.

 

Ammonium sulfate precipitation:

The optimal enzyme deposition ratio with the highest purity was found by centrifuging at 6000rpm for 20 minutes with ammonium sulfate in various saturation ratios (25-35-45-55-65-75%). The supernatant is discarded, and the precipitate is added to 0.05 M Tris-HCl solution (pH 8) to measure protein activity¹⁰. After 3 hours of dialysis, the enzyme was isolated from the brine and the enzyme remains in the dialysis bag for 24 hours and stored at 4°C for purification.

 

Ion exchange purification, Gel filtration chromatography purification, and Determination of molecular weight of protease:

DEAE-Cellulose ion exchange column was prepared according to the method described by¹¹; it was used after dialysis step. While, the filter gel as recommended by the Pharmacia Fine Chemical Company was prepared by placing a gram of the Sephadex G-200 substance in 500 ml of distilled water, then placed in a column with dimensions of (2.5 x 20) cm and left until it solidifies. Slowly pour ten milliliters of enzyme onto the gel-filter column's surface. The flow rate adjusts at 5ml / 3min, and the protein absorption was measured at a wavelength of 280nm. The molecular weight of the protease band in SDS-PAGE was determined approximately¹².

 

Determination of anti-cancer:

MTT assay has been achieved for the determination effect of a protease enzyme on cell lines; a microliter plate with 96 wells was used to perform this experiment. Two types of cell lines were examined, HepG2 (liver cancer cells) and WRL-68 (normal liver cell), were obtained from the Biotechnology Research Center, Al-Nahrain University. The cells were treated in duplicate with different concentrations of protease enzyme (100-600)µg/ml, and then incubated together for 24 hours to detect the cytotoxic effect of the enzyme; briefly, 10 microliter of MTT solution was added to each well, and the plates were incubated for 4 hours at 37^OC, the absorbance was measured at 570nm, to determine the cytotoxicity of Protease vis both cell lines. The inhibitory rate of cell division was assayed by equation Inhibition rate% = (A-B/A) X100. (A were the optical density of control and B were the optical density of the tested sample)¹³.

 

RESULTS:

Identification of bacteria by 16srRNA gene:

Amplification of the 16srRNA gene of isolates was employed to the identification of bacteria. The PCR products were investigated on agarose gel Figure 1. The target gene appeared in all isolates of Staphylococcus aurous (100%) with (756 bp),

 

 

Figure 1. Bands of agarose gel electrophoresis for 16S rRNA gene PCR product; M: 100 bp DNA marker, 1-8 :the band size of the sample is about 756 bp

 

Antibiotics susceptibility test:

In the tests, figure (2) was showed that all of the isolates were resistant to Aztreonam and Amikacin 100%, in another hand appeared sensitive (100%) to both Levofloxacin and Gentamycin, while showed an available response to the rest antibiotics, (75%) for each Ceftriaxone, Azithromycin, Augmentin, and Ampicillin, (50%) to Cefixime, (25%) to Norfloxacin, Imipenem and Cephalothen.

 

Figure 2. The resistance percentage of Staphylococcus aurous isolates to antibiotics.

 

Optimum conditions for protease production:

Twenty (66.7%) of 30 isolates produced protease. The optimum pH for protease synthesis was found to be 8 with the highest enzymatic activity (8.3units/ml) as illustrated in Figure (3). In another hand, as indicated in Figure (4), the enzyme activity was appears (9.1) unite/ml in 37C°, which is one ofthe most essential elements determining the production.

 

 

Figure 3. Effect pH on Staphylococcus aureus protease

 

 

Figure 4. Effect of temperature on Staphylococcus aureus protease

 

Ammonium sulfate precipitation and Ion exchange chromatography:

As an initial purification step, ammonium sulfate was deposited to find out the degree of saturation of the enzyme deposition ,the precipitation of ammonium sulfate was given at 65% with specific activity was 47.8 units/mg table (1). Figure (5) shows one peak of protein in the wash step and one peak of enzyme activity in the wash step. The enzyme has a positive charge similar to the substance present in the ion exchange column, which is DEAE-Cellulose. The specific activity in this step 97.5units/mg. enzymatic activity 15.6 units/ ml and yield reached 43.3 tables (1).

 

 

Figure 5.Ionic Exchange Chromatography for protease enzyme from Staphylococcus aureus through DEAE-Cellulose column (2.5 x30) cm. The column was calibrated with 0.05 M Tris-HCl pH 7, flow rate 5 ml/ 3 min.

 

Gel filtration chromatography:

A column of gel filtration utilizing a column of Sephadex gel filter material should be used to purify the enzyme solution after the ion exchange step , figure (6) was revealed two protein peaks, but only one enzyme peak, The enzymatic activity in this step is 17.3 units /ml and the number of purification fold is 5.91 table (1).

 

Determination of molecular weight of protease

The results using the SDS-PAGE gel showed the molecular weight of the protease was 37 KD figures (7).

 

 

Figure 6. Gel filtration chromatography for purified protease from Staphylococcus aureus by using Sephadex G-200 (2.5x20) cm. The column was calibrated with 0.05M Tris-HCl pH 7; 5 ml/3 min.

Table 1. The purification steps of protease from Staphylococcus aureus

Purification Step	Volum (ml)	Enzyme activity (U/ml)	Protein co006Ecentration (mg/ml)	Specific activity (U/mg)	Total activity (U)	Purification fold	Yield %
Crude enzyme	1oo	9	0.35	25.7	900	1	100
Precipitation with 60% saturation of (NH4)SO4	47	11	0.23	47.8	517	1.86	57.4
Ion exchange chromatography (DEAE-Cellulose).	25	15.6	0.16	97.5	390	2.04	43.3
Gel filtration chromatography	20	17.3	0.03	576.7	346	5.91	38.4

 

 

Figure 7: The molecular weight of protease produced by Staphylococcus aureus

 

Anti-cancer activity of the protease:

The results revealed that the cytotoxicity for HepG2 was 8% at 200mg/ml, then increased gradually with higher concentrations until to reach 60% at 1000µg/ml, But WRL-68 cells appeared a high resistance to all concentrations of the purified enzyme as in figures (8).

 

Figure 8.Cytotoxicity effect of purified protease on cell MCF-7

 

DISCUSSION:

Identification by moleculat techniques such as emolpy 16SrRNA gene amplification or  another specific genes are preserved in different bacteria, Parasite,and viruses , were give accurate result in the identification of bacteria, there are many reports appeared used these genes in diagnostic procedure for Staphylococcus aurous^14,15,16

Clostridium perfringens¹⁷, Brucella melitensis¹⁸, Proteus vulgaris¹⁹, Pseudomonas aeruginosa ²⁰, Toxoplasma spp ^21,22, and SARS-Cov-2 ²³. The results of antibiotic susceptibility test were agreed with previous studies done by authors^24,25. Bacterial survival in antibiotic-rich environments can be attributed to various mechanisms, such as B-Lactam enzyme cleavage, reduced permeability to reduce antibiotic uptake, efflux pumps that evict antibiotics from the bacterial body, R-plasmids that help enhance bacterial resistance, or by changing the metabolism pathway in bacteria ²⁶. Protease is an extracellular enzyme secreted outside the bacterial cell into the production media. So, unlike intracellular enzymes, it is easily extracted once the cells are deposited, and the culture medium and crude enzyme are recovered by centrifuging the cells and the culture medium utilized. In the extraction procedure, the enzyme represents the collected supernatant, purifying it and testing its enzymatic activity. pH value had the opposite effect on enzyme production due to the change in the triple structure of the protein, pH affects enzyme production through its effect on solubility and ionic state of the culture medium, in addition to the growing effectiveness of the organism to produce the enzyme from it²⁷. This study was similar to that search related with pH value that done by²⁸. In another study noticed that the best production of the enzyme was at neutral acid medium²⁹. One of the enzyme's characteristics is (denatured) that causes a drop in reaction rate by temperature³⁰. The best temperature for purified protease without denaturation was 50°C in some studies were done by³¹, while the maximum protease production by Bacillus subtilis was 40°C without and dropping in activity that reported by²⁹. Among the steps were applied in purification, is participate by salting out and salting in, Some studies were reported that the precipitation at 50% ammonium sulfate saturation gave protease maximally with a specific activity of 29.47 U/mg and 1.67 fold purification³². Also, the protease produced by Bacillus subtilis M33 was up to 15.5 purification fold with a yield of 38.66% after passage the enzyme through the DEAE cellulose exchanger column³³. These results are compatible with different previous studies, such as the molecular weight of the purified protease from Bacillus licheniformis is about 40 KD³⁴.Whereas, another enzymes such as Chondroitinase was extracted and purified by precipitation with 60% saturation of ammonium sulphate, dialysis, and followed by column chromatography on Sephadex 6B ^35,36. The protease enzyme has prospect cytotoxic effects on cancer cells compared with normal cells. It is interesting to find a local study revealed the cytotoxic effect of the metalloprotease purified from Aeromonas hydrophila in killing (85%) of liver cancer cells (HepG2) and was less toxic for normal liver cells WRL-68(5%) ³⁷. A similar study was observed the cytotoxic ability of partially purified protease produced by Aeromonas hydrophila vis RD and L20B cell lines³⁸. In another hand another enzymes such as elastase was consider type of protease has shown role in weakened and disorder of Vero cell line monolayer³⁹. The connective tissue proteins of cancer cells are a friable weak made them easily degradable by proteases enzymes, but the extracellular matrix proteins of normal cells are strong and may need a longer time and a high concentration of protease enzyme to get the destruction of cells ³⁹. Both neuramedinase enzyme alone and in combination with the oncolytic activity of a non-virulent strain of the newcastle disease virus were used to successfully treat adenocarcinoma in mice ^40,41.The protease inhibitors from Soyabean (Glycine max) that were partially purified were efficient against MCF-7 cells and protective against Vero cells. As a result, the partially purified enzymes were able to cause selective toxicity in cancer cells while remaining non-toxic to normal cells⁴². There are more applications for cancer treatment, such as the impact of silver nanoparticles synthesized utilized as an anti-cancer agent ^43,44, Hexane bark extract had shown more percentage of inhibition on A431 cell lines, PC-3 (Prostate carcinoma), A-431 (Epidermoid carcinoma), HeLa (Human cervical carcinoma), and MCF⁴⁵ . More ever, Acridone Analogues have efficacy in vitro against Ehrlich Ascites Carcinoma (EAC)⁴⁶. Also, Ethanolic extracts of leaves, fruits and stem of Tribulus terrestris and leaves of Bougainvillea spectabilis were evaluated for anticancer activity⁴⁷. When it comes to tumor cells, Human Alpha-lactalbumin Makes Lethal to Tumor cells, it penetrates tumors but not healthy cells, accumulates in their nucleus, and kills them by apoptosis⁴⁸. Anti-cancer activity of ethanolic and aqueous extracts of Peristrophe bivalvis Merrill's leaves and stems was tested in EAC cell lines⁴⁹. Adenanthera pavonina is a significant traditional plant having a variety of medicinal characteristics that may be used to treat a variety of common human diseases. It was conducted to determine the antibacterial and anticancer properties of the seed and leaf extracts of the red wood plant⁵⁰ . In another side, numerous natural compounds derived from marine sources have promise anticancer action⁵¹.

 

 

CONCLUSIONS:

The protease that is made from Staphylococcus aurous may have a role and provide prospect chance to remediation of tumors cells as alternative or promote anti-tumor drug through degradation of extracellular matrix (Proteins in connective tissue) of tumor mass and become unarmed, allowing the immune system to devour tumors more easily.

 

CONFLICT OF INTEREST:

The authors have no conflicts.

 

ACKNOWLEDGMENTS:

The authors would like to thank all who support us.

 

REFERENCES:

1.     Geo. F. Brooks, Morse SA, Brooks GF, Butel JS. Jawetz, Melnick, & Adelberg's Medical Microbiology. (23rd) ed. Lange Medical Books/McGraw-Hill, Medical Pub. Division; 2004.

2.     Türkyilmaz S, Kaya O. Determination of some virulence factors in Staphylococcus spp. isolated from various clinical samples. Turkish Journal of Veterinary and Animal Sciences. 2006; 30(1):127-132.

3.     Cahill TJ, Baddour LM, Habib G, Hoen B, Salaun E, Pettersson GB, Schäfers HJ, Prendergast BD. Challenges in infective endocarditis. Journal of The American College of Cardiology. 2017; 69(3):325-344.

4.     Asha B, Palaniswamy M. Optimization of alkaline protease production by Bacillus cereus FT 1 isolated from soil. Journal of Applied Pharmaceutical Science. 2018; 8(02):119-127.

5.     Salleh AB, Razak CN, Rahman RNZRA BM. Protease: introduction. New Lipases and Proteases. New York, NY, USA: Nova Science Publishers, Inc. 2006:23-39.

6.     Mitchell G, Lamontagne CA, Brouillette E, Grondin G, Talbot BG, Grandbois M, Malouin F. Staphylococcus aureus SigB activity promotes a strong fibronectin–bacterium interaction which may sustain host tissue colonization by small‐colony variants isolated from cystic fibrosis patients. Molecular Microbiology. 2008; 70(6):1540-1555. https://doi.org/10.1111/j.1365-2958.2008.06511.x

7.     Morello JA, Granato PA, Mizer HE. Laboratory manual and workbook in microbiology. In 831 McGraw Hill, London; 2006, 37: 632–687.

8.     Drapeau GR. The primary structure of staphylococcal protease. Canadian Journal of Biochemistry. 1978; 56(6):534-544.

9.     Manachini PL, Fortina MG, Parini C. Thermostable alkaline protease produced by Bacillus thermoruber—a new species of Bacillus. Applied Microbiology and Biotechnology. 1988; 28(4):409-413. doi:10.1007/BF00268205

10.  Takahashi E, Kobayashi H, Yamanaka H, Nakanishi M, Tateishi A, Abe T, Arimoto S, Negishi T, Okamoto K. Analysis of carboxy terminal domain of metalloprotease of elastolytic Aeromonas hydrophila. Biological and Pharmaceutical Bulletin. 2013; 36(7):1174-1182.

11.  Whitaker JR, Bernhard RA. Experiments for: An Introduction to Enzymology. 1972. The Whiber Press. Davis, California.

12.  Garfin DE. Method in Enzymology .2009. Academic Pres: 497-513.

13.  Freshney RI. Culture of Animal Cells. A manual of Basic Technique and Specialized Applications. 2015. 6th ed. John Wiley and Sons, Inc, USA.

14.  Johnson EJ, Zemanick ET, Accurso FJ, Wagner BD, Robertson CE, Harris JK. Molecular identification of Staphylococcus aureus in airway samples from children with cystic fibrosis. PloS one. 2016; 11(1):e0147643. Doi: 10.1371/journal. pone.0147643

15.  Ali M, Al-Rubaii B. Study of the Effects of Audible Sounds and Magnetic Fields on Staphylococcus aureus Methicillin Resistance and mecA Gene Expression. Tropical Journal Natural Product Research. 2021;5(5):825-830.

16.  Fakhry S, Hammed Z, Bakir W et al. Identification of methicillin-resistant strains of Staphylococcus aureus isolated from humans and food sources by use mecA 1 and mecA 2 genes in Pulsed-field gel electrophoresis technique. Bionatura. 2022; 7(2), 44. http://dx.doi.org/10.21931/RB/2022.07.02.44.

17.  Hashim S, Fakhry S, Rasoul  L et al. Genotyping toxins of Clostridium perfringens strains of rabbit and other animal origins. Tropical Journal Natural Product Research .20121; 5(4):613–616.

18.  Awadh H, Hammed Z, Hamzah S  et al. Molecular identification of intracellular survival related Brucella melitensis virulence factors. Biomedicine (India).2022; 42(4):761–765.

19.  Saleh T, Hashim S, Malik S et al. Down-Regulation of flil Gene Expression by Ag Nanoparticles and TiO2 Nanoparticles in Pragmatic Clinical Isolates of Proteus mirabilis and Proteus vulgaris from Urinary Tract Infection. Nano Biomedicine and Engineering. 2019; 11(4): 321-332.

20.  Shehab Z, AL-Rubaii B .Effect of D-mannose on gene expression of neuraminidase produced from different clinical isolates of Pseudomonas aeruginosa. Baghdad Science Journal. 2019; 16(2):291–298.

21.  Jiad A, Ismael M, Muhsin S et al. ND2 Gene Sequencing of Sub fertile Patients Recovered from COVID-19 in Association with Toxoplasmosis. Bionatura. 2022; 7(3), 45. http://dx.doi.org/10.21931/RB/2022.07.03.45.

22.    Jiad A, Ismael M, Salih T, Malik S, Al-Rubaii B. Genotyping and evaluation of interleukin-10 and soluble HLA-G in abortion due to toxoplasmosis and HSV-2 infections.Annals of Parasitology. 2022; 68(2):385–390

23.  Rasoul L, Nsaif M, Al-Tameemi  M et al. Estimation of primer efficiency in multiplex PCR for detecting SARS-Cov-2 variants. Bionatura, 2022, 7(3), 48. http://dx.doi.org/10.21931/RB/2022.07.03.49

24.  Karmakar A, Dua P, Ghosh C. Biochemical and molecular analysis of Staphylococcus aureus clinical isolates from hospitalized patients. Canadian journal of infectious diseases and medical microbiology. 2016. http:/dx,doi,org/10.1155/2016 /9041363.

25.  Ibrahim HT. Fibronectin binding protein genes expression in respect to Biofilm formation in Methicillin resistance Staphylococcus aureus. 2018. Ph.D thesis, Baghdad University. College science. Biology department. Iraq.

26.  Munita JM, Arias CA. Mechanisms of antibiotic resistance. Microbiology spectrum. 2016; 4(2):4-2.

27.  Asgher M, Asad MJ, Rahman SU, Legge RL. A thermostable α-amylase from a moderately thermophilic Bacillus subtilis strain for starch processing. Journal of food engineering. 2007; 79(3):950-955.

28.  Fitriani S, Güven K. Isolation, screening, partial purification and characterization of protease from halophilic bacteria isolated from Indonesian fermented food. Anadolu University Journal of Science and Technology C-Life Sciences and Biotechnology. 2018;7(2):130-142.

29.  Pant G, Prakash A, Pavani JV, Bera S, Deviram GV, Kumar A, Panchpuri M, Prasuna RG. Production, optimization and partial purification of protease from Bacillus subtilis. Journal of Taibah University for Science. 2015; 9(1):50-55.

30.  Uyar F, Porsuk I, Kizil G, Yilmaz EI. Optimal conditions for production of extracellular protease from newly isolated Bacillus cereus strain CA15. EurAsian Journal of BioSciences. 2011; 5:1-9.

31.  Ilmiah SN, Mubarik NR, Wahyuntari B. Characterization of Protease from Bacillus licheniformis F11. 1 as a Bio-Detergent Agent. Makara Journal of Science. 2018; 22 (3):105-112.

32.  Lakshmi B, Muni Kumar D, Hemalatha K . Purification and characterization of alkaline protease with novel properties from Bacillus cereus strain S8. Journal, genetic engineering & biotechnology, 2018; 16(2), 295–304. https://doi.org/10.1016/j.jgeb.2018.05.009.

33.  Karaboğa MN, Loğoğlu E. Purification of alkaline serine protease from local Bacillus subtilis M33 by two steps: a novel organic solvent and detergent tolerant enzyme. gazi university journal of science, 2019; 32, 116-129.

34.  Aguilar JG, de Castro, RJS, Sato HH. Alkalin protease production by Bacillus licheniformis LBA 46 in a bench reactor: effect of temperature and agitation. Brazilian Journal of Chemical Engineering, 2019; 36 (2), 615-625.

35.  Abdul-Gani M, Laftaah B . Purification and characterization of chondroitinase ABC from Proteus vulgaris, an Iraqi clinically isolate. Current Science.2017; 113(11):2134-2140.

36.  AL-Imam M, AL-Rubaii B. The influence of some amino acids,vitamins and anti-inflammatory drugs on activity of chondroitinase produced by Proteus vulgaris caused urinary tract infection. Iraqi Journal of Science,2016; 57 (4A):2412-2421.

37.  Abdallah MM, Saleh TS. The cytotoxicity effect of metalloprotease produced and isolated from Aeromonas spp. The Iraqi Journal of Veterinary Medicine, 2018;42(1),41-45.

38.  AL Rubai BA. Detection of cytotoxic activity of clinical isolates of Aeromonas hydrophila on RD andL20B cells. Al- Mustansiriyah Journal of Science. 2011; 22(4), 64-78.

39.  Bahaa Abdullah Laftaah al-Rubai . Cloning LasB gene of Pseudomonas auroginosa 10104-2AI in E.coli BL21 and E.coli DH5α and investigated their effect on the stripping of Vero cells. Pakistan Journal of Biotechnology. 2017; 14 (4) , 697-705.

40.  Ali, S.M., Lafta, B.A., Al-Shammary, A.M., Salih, H.S. In vivo oncolytic activity of non-virulent newcastle disease virus Iraqi strain against mouse mammary adenocarcinoma. AIP Conference Proceedings. 2021, 2372, 030010.

41.  Ali, S.M., Laftah, B.A., Al-Shammary, A.M., Salih, H.S. Study the role of bacterial neuraminidase against adenocarcinoma cells in vivo. AIP Conference Proceedings.2021, 2372, 030009.

42.  Mayasa V, Rasal VK, Unger BS, Subbarayan K. Tolerability assessment and anti cancer activity of the partially purified protease inhibitors from Soyabean (Glycine max) orally administered to rats. Research Journal of Pharmacy and Technology. 2016; 9(7):925-928. doi: 10.5958/0974-360X.2016.00177.3.

43.  SK, Jayakumar D, Kumar R, Bharani RA. Anti Bacterial and Anti Cancerous Biocompatible Silver Nanoparticles Synthesised from the Cold Tolerant Strain of Spirulina platensis. Research Journal of Pharmacy and Technology.2014; 7(12): 1404-1412.

44.  Menon S, Agarwal H, Rajeshkumar S, Kumar SV. Anticancer assessment of biosynthesized silver nanoparticles using Mucuna pruriens seed extract on Lung Cancer Treatment. Research Journal of Pharmacy and Technology. 2018; 11(9):3887-3891. doi: 10.5958/0974-360X.2018.00712.6.

45.  Gowri SS. In vitro anticancer activity of Majidea zanquebarica J. Krik. ex Oliv.(Sapindaceae). Research Journal of Science and Technology. 2020;12(3):173-176. doi: 10.5958/2349-2988.2020.00023.6

46.  Velingkar VS, Dandekar VD. Microwave-assisted synthesis and evaluation of anticancer activity of substituted acridone analogues. Research Journal of Pharmacy and Technology. 2009; 2(2):366-370.

47.  Kumar DJ, Sonia K, Madhan R, Selvakumar K, PT K. Antiyeast, antioxidant and anticancer activity of Tribulus terrestris Linn and Bougainvillea spectabilis Linn. Research Journal of Pharmacy and Technology. 2011; 4(9):1483-1489.

48.  Pagare MS, Joshi H, Patil L, Kadam VJ. Human milk: excellent anticancer alternative. Research Journal of Pharmacy and Technology. 2012;5(1):14-19.

49.  Tanavade SS, Naikwade SN, Chougule DD. In vitro anticancer activity of Ethanolic and Aqueous Extracts of Peristrophe bivalvis Merrill. Research Journal of Pharmacy and Technology. 2012; 5(10):1324-1327.

50.  Chauhan R, D'Souza HL, Shabnam RS, Abraham J. Phytochemical and cytotoxicity analysis of seeds and leaves of Adenanthera pavonina. Research Journal of Pharmacy and Technology. 2015; 8(2):198-203. doi: 10.5958/0974-360X.2015.00036.0

51.  Dighe NS, Pattan SR, Musmade DS, Merekar AN, Kedar MS, Thakur DK, Patel PV. Recent Synthesis of Marine Natural Products with Anticancer Activity: An Overview. Research Journal of Science and Technology. 2009; 1(2):63-70.

 

 

 

Accepted on 21.05.2022           © RJPT All right reserved

Research J. Pharm. and Tech 2022; 15(12):5415-5420.